Часть №6. Введение в сворачивание многоспиральных РНК

в 13:23, , рубрики: Алгоритмы, биоинформатика, Биотехнологии, кибернетика, математика, сворачивание рнк, теория игр, Фолдинг белков, метки: , , , ,

Итак, в прошлых частях мы разобрались как сравнительно просто сворачивать спирали РНК. Теперь нам предстоит понять, как вообще сворачивается РНК. То РНК, которые мы взяли в виде примера имеет три спирали. Две из них L1 и L2 можно свернуть независимо. А вот с третьей проблемы. Эта третья состоит из концов РНК, и при ее сворачивании начинаю двигать наши свернутые спирали L1 и L2. Во-первых, при этом они мешают друг другу, и следовательно и сворачиванию третьей спирали. Во-вторых, возможно образование около десятка разнообразных псевдосимметричных структур — спирали L1, L2 могут по разному располагаться по отношению к сворачиваемым концам РНК.

Здесь мы попробуем разобраться как эти проблемы решить.

Снова повторим рисунок

Часть №6. Введение в сворачивание многоспиральных РНК

Как я писал в прошлой части в комментариях это вироидный рибозим Chrysanthemum chlorotic mottle viroid (NC_003540). Получена только его первичная последовательность, а третичной еще нету. Но мы её попробуем получить в компьютерной модели in silico.

Вторичную структуру (водородные связи между нуклеотидами) хорошо предсказывают ряд уже существующих программ, например, тут. Но что важно! Они предсказывают водородные связи только спиралей. Но дело в том, что для того, чтобы спирали удерживались бы вместе существуют межспиральные водородные связи.

Как их узнать? Но мы знаем, что рибозимы имеют близкую (консервативную) структуру на некоторых участках. Возьмем ту, которая уже есть в банке данных PDB. Например, satellite tobacco ringspot virus hammerhead RNA (2QUS)

Она получена путем рентгеноструктурной кристаллографии, и там увы нет атомов водорода, и не видны водородные связи. Но если посмотреть подробнее (померить расстояния между определенными атомами), то достаточно легко можно обнаружить где эти водородные связи должны быть. Стандартные нас не интересуют, поэтому ищем те которые стягиваю спирали вместе и прочие нестандартные. И находим.

Они есть между нуклеотидами a46-u19, a46-u24, с32-g37.

Хорошо, но каким парам нуклеотидов — это соответствует в интересующем нас (NC_003540) рибозиме?

Тут необходимо сделать т.н. выравнивание. Есть две первичных последовательности:

1. (NC_003540) aagaggucggcaccugacgucgguguccugaugaagauccaugacaggaucgaaaccucuu
2. (2QUS в PDB) gggagcccugucaccggaugugcuuuccggucugaugaguccgugaggacaaaacagggcucccgaauu

А выровнять их не так тривиально. Тут я попрошу специалистов, которые меня читают это сделать. А потом мы сравним результаты. Я утверждаю, что современные программы, которые делают сравнение автоматически с этим не справляются. Давайте проверим?

Дальше предположим мы нашли какие межспиральные водородные связи нужно образовать. И тут нас ждет следующая проблема. А проблема в том что мы поверили гипотезе, согласно которой вначале сворачиваются вторичные структуры и только потом происходит последующие сворачивание (т.н. Hierarchical model). Эта модель неверна, как минимум для того, чтобы использовать в компьютерных вычислениях.

Почему? Дело в том, что образование спирали жестко связывает положение петли (свобода нуклеотидов в петли становится очень малой). Различных видов петель можно образовать много. У нас же, где критерием является только образование водородных связей спирали — петля получается почти случайной. А нам нужно, чтобы петля спирали L1 наиболее близко упаковалась с петлей L2. Если этого не произойдет то требуемые нам межспиральные связи мы не образуем.

Но и это еще не все сложности. В прошлой части в комментариях я показывал как водородные связи между спиралями могут подойти не с той стороны как нужно, а с другой и при этом все будет нормально. Только спираль L3 не сможет потом образоваться.

Но что нужно, чтобы спирали L1 и L2 подошли друг к другу с правильной стороны? Оказывается могут не все решать водородные связи. Важное влияние оказывает т.н. стэкинг взаимодействия. Но если мы будем учитывать эти взаимодействия между всеми нуклеотидами, то мы потратим слишком много времени.

Кроме того, я не нашел достаточно точного математического описания стэкинг взаимодействия (аналогичного, тому как я описывал водородные связи). Может кто подскажет?

В любом случае, мы находим то критическое для сворачивания стэкинг взаимодействие и тогда наши спирали подходят друг к другу с правильной стороны.

Ну, вот и вся технология. Дальше только практика.

Автор: tac

Поделиться

* - обязательные к заполнению поля